The Cobra Event (23 page)

Tanaka put another sample in the electron microscope. “We’re looking inside one of Dr. Dudley’s brain cells,” she said. She spoke of his cells in a personal way, as if she might be speaking of a hand or an arm. The crystals inside the cells were chunks of material sitting in the cell’s nucleus. Some of the crystals were cracking open and seemed to be releasing particles into the cell’s cytoplasm, the cell’s interior. The particles resembled rods or batons. In places, Tanaka found the rods floating around inside a brain cell without any crystal material near them.

“Dr. Dudley’s brain cells are a mess,” Tanaka said to Austen in a low voice. “This is as bad as Ebola.”

“Have you seen Ebola?” Austen asked.

“Sure. Part of our training. This isn’t Ebola.”

“Do you think you know what it is?”

“I’m not ready to say, Alice. I
think
I know.”

Austen was standing behind her, looking down at the screen. She felt dizzy, as if she were falling into the depths of a microscopic universe that extended inward to infinity.

“I have to be careful here,” Tanaka went on. “There is a type of virus that makes crystals like this. It lives in butterflies and moths.”

“It lives in butterflies?”

“Yup,” Tanaka said.

Tanaka had brought reference textbooks with her. When you are looking at virus particles in a microscope, trying to make a visual identification of the virus, you check the images against photographs in a book, in the same way that a bird-watcher might look up photographs of birds in an Audubon field guide.

Tanaka went over to a military transport box sitting in a corner of the imaging room. She threw the catches, and pulled out a textbook on viruses. She closed the box and sat down on it, and opened the volume on her lap. Austen sat beside her. Tanaka flipped through the table of contents, then turned to a page about halfway into the book. “There,” she said, putting her finger on a photograph.

She had come to a section on insect viruses. The photograph showed images of crystals.

“This is nuclear polyhedrosis virus,” Tanaka said to Austen. “That’s kind of a mouthful. Let’s call it N.P.V. You know, like H.I.V.? This is N.P.V. This virus scares the hell out of me.”

Austen saw that Tanaka wasn’t kidding when she said the virus frightened her. Tanaka’s breathing hood had misted up, a sure sign of upset. “The crystals are a kind of protein, I think,” Tanaka said, her voice not strong. She said that the virus particles were clumped inside the crystals. “The crystals are like—kind of—protective shells around the virus. They protect the virus from harm. This thing is an engineered weapon, Alice.”

Tanaka returned to the microscope and began snapping photographs with an electronic camera that was attached to it. Image by image, huge crystals appeared on a video screen. The two women looked at cells from the golden areas in Dudley’s irises. The cells were full of crystals. It was the crystals, forming in the pupillary ring around the iris, that gave the eyes the yellow-gold color. There were crystals in the optic nerve leading to the eye. The virus had either migrated through the eyes into the brain along the optic nerve, or it had spread out of the brain to the eyes.

They were seeing a life-form that Austen had seen earlier through the optical microscope in Glenn Dudley’s office, when she had first looked at Kate Moran’s brain tissue in a microscope. Then she had seen fuzzy shapes, without much clarity. Here, the clarity was superb, and the crystals loomed like planets.

“We have to tell Will,” Tanaka said.

The Code

WILL HOPKINS
, now dressed in surgical scrubs but not a space suit, had set up a work area on a table in the conference room. While Tanaka was attempting to make an image of the virus particles, he would try to “see” the DNA of the virus using his machines. In this way, he hoped to get a rapid identification of the virus.

He hooked up the two Felix machines on the table. He deployed several other small machines as well. He also put out a bagel with cream cheese, which he munched while he worked. Wires and cables trailed everywhere.

Hopkins had a sample of Cobra dust in a small plastic test tube the size of a baby’s finger. The dust had been sterilized with chemicals and mixed with a few drops of water. It wasn’t dangerous. It contained a quantity of DNA from the virus. He held the tube up to a bright light and swirled it around. Sometimes you could actually see DNA with your naked eye—it formed milky lumps in a test tube. This time, he couldn’t see any, but the water in the test tube was nevertheless full of strands of DNA, like a soup made with angel hair pasta. He put a droplet of the water (containing DNA from the virus) directly into a sampling port in one of the Felix machines.

Felix began reading the DNA, but nothing came up on the screen. Felix was having some problems. Hopkins had to resist a temptation to bang Felix with his hand, the way you’d bang a television that isn’t working.

Just then Austen and Tanaka came in. Tanaka’s face was radiant, she was beaming, but holding back.

“I’m having trouble getting gene sequences here,” Hopkins said to them.

“Take a look at this,” Tanaka said. She laid the photographs in front of Hopkins.

“Whoa,” he said. He stared at the photographs, chewing bagel.

“These are particles we recovered from Glenn Dudley’s brain,” Suzanne Tanaka said.

“Midbrain. The part of the brain that controls primitive behavior, such as chewing,” Austen added.

“Look at the crystals, Will,” Suzanne Tanaka said. “See that blocky shape? This
looks
like the nuclear polyhedrosis virus, N.P.V., which lives in butterflies. It isn’t supposed to live in people.”

Hopkins stood up slowly, a look of wonder on his face. “It lives in people now,” he said. “My God, Suzanne! A butterfly virus. This is great!” He slapped her on the back. “Suzanne, you are the best!”

She looked very pleased. She didn’t say anything.

“All right!” Hopkins said. “All right.” Now he paced the room. He ran his hands over his face. “All right. What are we gonna do, guys? Are we going to tell Frank Masaccio we’ve got a
butterfly
virus? He won’t believe us. He’ll think we’ve gone lunatic.”

In biology, the shape of an organism may not tell you how it fits into the evolutionary tree of life. Many viruses look alike in a photoscope but are very different at the genetic level. “We need some genes,” Hopkins said. “We need a gene fingerprint. Felix is gonna
prove
this thing is a butterfly virus. I’m scanning genes already, but I haven’t put it together.”

He bent over the Felix machine, his hands flying, working like a madman.

Austen found herself watching Hopkins’s hands as he worked. His hands were muscular, but they were gentle and precise in their motions. There was no trembling, no hesitation, no spare or useless movement. His hands were in perfect control. These were trained hands, the hands of a gadgeteer. “I’m purging the system. We’ll try again.”

Using a micropipette, he put another sample of DNA into Felix. Still standing, he tapped the computer keys, and letters of text began to appear.

ttggacaaacaagcacaaatggctatcattatagtcaagtacaaagaattaaaatcgagagaaaacgcgttcttgtaaatgcctgcacgaggttttaacactttgccgcctttgtacttgaccgtttgattggcgggtcccaaattgatggcatctttaggtatgttttttagaggtatc

This was genetic code from somewhere in the DNA of the Cobra virus.

Molecules of DNA resemble a spiral ladder. The rungs of the ladder are known as the nucleotide bases. There are four types of bases, and they are denoted by the letters A, T, C, and G. (The letters stand for adenine, thymine, cytosine, and guanine—nucleic acids.) The length of the DNA in living creatures varies greatly. Human DNA consists of about three billion bases. That’s enough information to fill three
Encyclopaedia Britannicas
. All of this information is crammed into every cell in the human body. A small virus, such as the virus for the common cold, has only about 7,000 bases of DNA. Hopkins had made a guess that the Cobra was complicated and would probably contain around 50,000 to 200,000 bases of DNA.

Sometimes as few as a dozen bases of DNA code are enough to provide a unique fingerprint to a particular organism. You can use a computer program to match unknown code with known code. If you can make a match, then you can identify the organism the DNA came from. The process of matching unknown DNA code with known code is like the process of opening an unread book and reading a few lines from it. If the lines are familiar, then you can make a guess as to the book. For example, these words serve to identify a book:
In the beginning God created the heaven and the earth. And the earth was without form, and void
. The exact edition of the book (the “strain” of the book, so to speak) is the King James translation of the Bible in English.

As strings of letters marched across the screen, Hopkins hoped that he would soon have a better idea of what kind of book Cobra was.

gcaagcatttgtatttaatcaatcgaaccgtgcactgatataagaattaaaaatgggtttgtttgcgtgttgcacaaaatacacaaggctgtcgaccgacacaaaaatgaagtttccctatgttgcgttgtcgtacatcaacgtgacgct

The letters drifted in blocks across the screen. “Time to get on the Web,” Hopkins announced. He ran Netscape on one of the Felix laptops. His computer then socketed into the World Wide Web via the satellite dish sitting on the patio deck. In a few seconds, he arrived at a Web site known as GenBank. This site—it is in Bethesda. Maryland—has a huge database of genetic sequences. GenBank is the world’s central library of genetic codes.

Hopkins clicked a button on the screen. The GenBank computer looked at the code and began matching it to known genetic codes. Soon an answer came back:

Sequences producing High-scoring Segment Pairs:

Autographa californica nuclear polyh… 900 4.3e-67 1

Autographa californica nuclear polyh… 900 4.9e-67 1

Bombyx mori nuclear polyhedrosis vir… 855 2.4e-63 1

Bombyx mori nuclear polyhedrosis vir… 855 2.7e-63 1

It was a list of virus DNA codes that had shown close matches with the code that Hopkins had sent. The top line showed the closest match.

“Looks like we’ve got a rough identification of the Cobra virus,” Hopkins said. “That top line, right there, that’s the probable strain of the virus. That’s the closest match to Cobra.” His finger traced over

Autographa californica nuclear polyhedrosis virus

Cross section through a crystal of
Autographa californica
nuclear polyhedrosis virus. Magnification 25,000.
(Electron micrograph courtesy of Dr. Malcolm J. Fraser, Jr., and William Archer, Department of Biological Sciences, University of Notre Dame.)

Cobra virus was similar to the nuclear polyhedrosis virus, or N.P.V. (It is also called the baculovirus.) This particular strain lived in a moth. The moth was
Autographa californica
, a small brown and white moth that lives in North America. The caterpillar of the moth is a crop pest, a green inchworm known as the alfalfa looper. The virus invades the moth caterpillar and kills it. Cobra was based on a moth virus, but it had been altered.

N.P.V. is a common virus used in biotechnology labs all over the world. It is available to anyone, and Hopkins’s heart sank as he thought about this. The virus was going to be devilishly hard to trace back to its original source. It made him wonder if his idea of a Reachdeep operation was already in trouble.

The crystals that Tanaka had photographed were actually crystals of protein, with virus particles embedded in them, like seeds in a watermelon. The protein is called polyhedrin, because it forms rounded crystals that look like soccer balls: polyhedrons.

The genes of N.P.V. can be changed easily without causing harm to the virus. Many viruses are difficult to change. They are too sensitive. If you change their genes, they stop working. But N.P.V. is a rugged, tough, flexible virus. It can be given foreign genes that change its behavior as an infectious agent. Hopkins knew enough about viruses to know this, and it chilled his blood to make the identification. He knew that buried somewhere in the code of the Cobra virus he would find engineered genes. Genes that had been put there, enabling the virus to replicate in human tissue, specifically in the central nervous system.

Cobra was a recombinant virus, or a chimera. In Greek mythology, the chimera was a monster with a lion’s head, a goat’s body, and a dragon’s tail. “The chimera,” Hopkins whispered, “was a tough monster to kill.”

He put a few more drops of sample liquid into Felix and started Felix on another run, pulling up more DNA code. Austen had finished her autopsies, and for the moment she did not have work to do. She suited up and went back into the Core to see what was going on there. Suzanne Tanaka went back to work with her microscope.

Signatures

IN THE CORE
, James Lesdiu was running a forensic analysis of the physical materials used in constructing the two boxes. They were bombs. All bombs, as Hopkins had so passionately maintained at the S
IOC
meeting, contain forensic signatures that can guide an investigator to the builder of the bomb.