Spiral (23 page)

With the Uzumaki, they both agreed, it would be straightforward, once the United States had developed a cure.

Although a decade had since passed, Dunne could remember the conversation word for word. “Where would you release it?” Kitano had asked.

“One option is Harbin. Like construction stirred it up. Or near one of the Chinese agriculture ministry’s biological research facilities south of there. Make it look like the incompetent fools were working on the Uzumaki, accidentally released it themselves.”

“Like the Soviet anthrax incident at Sverdlovsk in ’79?”

“Exactly.”

Together they’d sketched out how it would go from there. The Uzumaki spreads, the country is isolated. Every other nation, fearful of a pandemic, shuts off travel, closes down trade with China. The Communist Party’s hold on power was already tenuous, propped up by the twin sticks of nationalist pride and the promise of economic growth. Robbed of that prosperity and angry at a leadership impotent before the spreading horror, the people would riot, first in the countryside, then in the cities. The State Council would collapse within weeks, the country plunging into chaos. The stage would be set for a joint United States–Japanese force to step in and restore order, backed by a cure and a bayonet.

If the United States developed a cure, Kitano and Dunne speculated, it could bring down China anytime it wanted. The two men shared a secret bond, one that deepened as China continued to rise in power. The Uzumaki, the Japanese superweapon, might still change history. It was almost a game with them: two men planning the downfall of the most populous nation in the world.

But then Kitano changed the game.

The first report that something was amiss had come to Dunne from the CIA. A consortium of Central American and Asian agricultural investors had purchased ten thousand acres of Brazilian farmland about four hundred miles from where Toloff had discovered
Fusarium spirale
. On it they built a multimillion-dollar agricultural genetics research institute and agricultural experiment station called SunAgra. It was staffed with dozens of Ph.D.-level scientists with expertise ranging from crop science to fungal genetics, all living and working on-site. Their stated goal was to develop new strains of genetically modified maize for Far East markets. On the face of it, quite reasonable: corn had become a key crop throughout Asia. China was the number-two producer and consumer of corn in the world, and North Korea had become completely dependent on the crop under Kim Il-Sung. A little digging, however, turned up a number of alarming details. For one, scientists at the SunAgra Institute published no papers, wrote no grants, and filed few patents. Furthermore, one of the species they studied was a rare fungus known as
Fusarium spirale
, a strange choice, since it was unknown outside of a four-province area of Brazil and had no apparent relevance to the Far East markets. And most alarmingly, the investor group was largely a shell. More than ninety percent of the money behind the project came from a single Japanese investor, the billionaire Hitoshi Kitano.

Kitano was running his own private Uzumaki program.

DUNNE HAD NO CHOICE BUT TO TAKE ACTION. BUT HE WAS
in a bind—Kitano could burn him. Much of the information Dunne had shared over the years during their China conversations was classified, putting him in violation of the State Secrets Protection Act. It was treason, sharing NOFORN classified information with a foreign national, not to mention plotting the overthrow of a foreign government. Such a thing could get you a very long prison term, possibly even a death sentence.

Dunne had provided Kitano with classified information, and in turn Kitano had shared insider information about certain publicly traded Japanese companies. Kitano could reveal this to federal prosecutors, how Dunne, while sipping Kitano’s expensive scotch, had indiscreetly shared sensitive state secrets and subsequently made a small personal fortune in the Asian stock markets.

Dunne had one thing in his favor. The U.S. government under no circumstances wanted to draw attention to the Uzumaki. The Japanese doomsday weapon was still unknown to all but a tightly held group in the security establishment. Toloff’s program at USDA was top secret, no foreigners. If word of it got out that the United States was tinkering around with a biological weapon of that magnitude, not to mention the connection to Unit 731 and the tests on Chinese civilians, Beijing would go ballistic.

But Dunne also knew that no organization as large as Kitano’s could stay entirely on the correct side of the law. He ordered some digging done, and the next time Kitano arrived in the United States, federal marshals arrested him for tax evasion. The trial was quick and antiseptic. Kitano remained silent throughout the trial, and never took the stand in his own defense.

Dunne had made sure of that. In a private meeting at Kitano’s estate before the trial, Dunne had threatened Kitano with the biggest weapon he had. “Tangle with me at your peril. We’ll disappear the Uzumaki program and then turn over everything on you to the Chinese Ministry of State Security: the records from Ishii, the photographs, the transcripts—anything and everything that implicates you in the torture and genocide of Chinese civilians. And after they’re good and worked up, we’ll turn
you
over to them for prosecution of war crimes.”

That had shut Kitano up. Neither man spoke for almost a minute. Finally Kitano had said, “You have no fear that I will tell the Chinese everything?”

“You don’t seem to realize that you lack any sort of credibility—a Japanese war criminal and mass murderer trying to save his skin? Listen closely. Beat the tax charges if you can, but close down SunAgra
immediately
. And stay far away from the Uzumaki.”

ROBBINS PERKED UP. “LOOK. HE’S MOVING.”

Kitano stood and went over to his small desk. He took down one of the books from his shelf, tore out a blank sheet from the back, then picked up a pen and set about writing.

“Can you read that?” Dunne asked.

“It’s too far away. Let me see if I can—”

Kitano pulled his chair to the center of the cell, directly under the camera, and grabbed the page on which he had written. Then he stepped onto the chair and held up the paper so the image filled the screen.

“Shit. He knows about the camera,” Robbins said.

Dunne barely heard him. He was transfixed by the message.

I CAN TELL YOU
WHO SHE IS

31

VLAD GLAZMAN TYPED AS HARPO READ OFF THE SEQUENCE
from the gel. The two had finished the second round of PCR and dielectrophoresis a half-hour ago, and were recording the genetic sequence of the glowing fungus. Harpo read off the bands, calling out a sequence of A’s, C’s, T’s, and G’s that Vlad dutifully transcribed.

Harpo halted, took a great big sigh.

“That’s it?” Vlad asked.

“That’s it.”

Vlad stared at the string of letters:

GACTCGACTAGCTAGCAATTACTGATCAGCATT TTSCCCAATGCAGCATTTTCGACTGACCCGACT CGACTAGCTAGCAATTACTGATCAGCATTTTSC CCAATGCAGCATTTTCGAGCAAATCAGACTCG ACTAGCTAGCAATTACTGATCAGCATTTTSCCC AATGCAGCATTTTCGAGACTCGACTAGCTAGCA ATTACTGATCAGCATTTTSCCCAATGCAGCAT TTTCGA …

It ran on for three pages.

“Run it through the translator.”

Vlad hit a sequence of keys, shipping the data to a simple script translator called BabelGene, which rendered it in alphanumeric form. Each three-letter codon corresponded to a letter of the alphabet, AAA for “a,” ACA for “b,” and so on. Connor had been the one that had originally proposed the standard.

BabelGene did its job, and the screen filled with text.

The Uzumaki is an extraordinarily dangerous weaponized version of the species known as
Fusarium spirale
. It is highly virulent, spreading by spores that can survive in human, avian, and agricultural hosts.…

“Christ,” Harpo said.

Vlad barely heard him, stunned as he read paragraph after paragraph detailing everything Connor had learned about the Uzumaki and everything he had done to try to defeat it. Not only that, but Connor said that he
had
one of the Uzumaki cylinders. Included in the message were the GPS coordinates of the location where it was hidden.

“Shit,” Vlad said. “Double shit.”

Vlad pushed Print. A LaserJet next to the computer fired up, spitting out a sheet of yellow paper with Connor’s revelations. Harpo grabbed the printout. “We should send this to someone.

Now. CDC. FBI. CIA. Someone.”

Vlad flipped his cellphone open. He hit Jake’s number. It rang once, then clicked off.

He tried it again. Same result.

He checked the bars. Plenty of signal. So what was wrong?

Then he heard a pop, felt a splash of liquid on his cheek.

Vlad turned.

Harpo was falling, the back of his head gone.

JAKE HEARD TWO SHOTS, THEN A QUICK BURST OF FOUR
more. He pulled at the cuffs, trying desperately to get loose. He was in the passenger’s seat of the FedEx van, held by a ring and chain welded to the floorboard. Maggie and Dylan were tied up in the back. A strap of flesh-colored tape covered his mouth.

The cuffs holding him were virtually indestructible, brushed stainless steel with a rubberized lining and connected by a flexible band made from some kind of reinforced plastic. His bones would break before the cuffs would.

He watched Harpo’s house, alert for any movement inside. Then another gunshot. Jake yanked with his arms, trying to pull loose the ring in the floor, but it was no use.

Jake saw movement. Vlad shuffled around the corner of the house, dragging his right leg behind him. He looked to be badly hurt, hopping forward, holding a yellow printout in his hand. He looked desperate, focusing on his goal, each hop deepening his grimace.

Jake tried to yell. Tried to warn him.

He had no idea Orchid was right behind him.

“VLADIMIR,” ORCHID SAID, AND WAITED FOR HIM TO TURN
.

She put the first bullet in his neck, just above the Adam’s apple. His mouth formed an
O
, but no sound came out. He went down straightaway, no fuss, gurgling and spitting up blood.

She stood over him. The yellow printout was still in his grasp, jittering with the firing of his dying nerves.

She knelt, put the silencer directly to his temple, and put in a second bullet to finish it.

She waited until he was still, then pried the printout from his fingers.

She stood. Her own hands were shaking. This was it. Success or failure.

She read the message. By the fourth paragraph, she knew the answer.

She glanced up. Jake was staring at her, hate in his eyes.

No matter. He would be dead soon.

Orchid folded the sheet of paper carefully and tucked it in a pocket. Within hours she would have the Uzumaki. Within days it would be done. Kitano would be dead, the Uzumaki would be free, and she would have all the money. She did something she hadn’t done in a long time.

Orchid smiled.

32

DUNNE STARED ACROSS THE TABLE AT KITANO, AND KITANO
stared back. The only other person in the room was an FBI interrogator named Felix Carter. No lawyers were present, no aides, no security personnel. Any information gained would have no criminal relevance, could not be used in a court of law. Kitano had demanded this in writing. He had something to tell them. He would do so only if he was granted blanket immunity.

Age was destroying Kitano, but he was putting up a hell of a fight. The man was nothing but bone and sinew. His eyes had yellowed, the pupils dark and cold, a contrast to his bright orange prison jumpsuit. Dunne was in a three-thousand-dollar blue pinstriped suit by H. Huntsman, one of four by that Savile Row tailor that hung in his closet. When Dunne had first met Kitano, his most expensive suit had come from Brooks Brothers. Their individual fortunes changed, a role reversal for the billionaire and the up-and-coming wonk, one ascending spectacularly, the other falling dramatically.

Kitano had three further stipulations. The first was that Dunne be physically present. Dunne knew why. Kitano had leverage on him and was prepared to use it.

The second one was unusual. Kitano kept a large pigeon rookery at his house in the Maryland countryside, north of Washington, D.C. Even in jail, he’d made sure the pigeons were attended by a full-time caretaker. Hitoshi Kitano demanded full and regular access to his pigeons.

Requirement number three was perhaps the most visceral, in that it demonstrated the primitive survival instinct. Dunne could tell by the videos of Kitano talking to the FBI. He knew Kitano’s body language like he knew his own father’s. Kitano said the woman was after him. She wanted to kill him, he was certain. Kitano’s whole body had stiffened when he’d said it, his hands held in tight fists. He was scared to death.

Demand number three: under no circumstances, no matter what happened, no matter what pressure she applied, could they turn him over to her.

IN THE ADJOINING ROOM WAS A TEAM OF INTERROGATION
experts analyzing the spectrum of Kitano’s voice patterns, the fluctuations in his pupil size, the electrical conductivity of his skin. The FBI interrogator would be getting real-time updates on Kitano’s stress levels.

The interrogator began by reading a summary of events pertaining to the woman. Dunne took no pleasure watching Kitano’s shocked reaction to the details of the victim taken to Bellevue, the “731 Devil” symbols carved into his chest. A similar reaction when Kitano learned of the finger bone in the cylinder with the words
KITANO MUST PAY
.

Before today, Kitano couldn’t talk about their cozy and highly improper relationship without getting himself in at least as much trouble as Dunne. But now the duplicitous rat had blanket immunity.

THE QUESTIONS STARTED EASY, QUERIES ABOUT KITANO’S
personal information, his business interests, all for the instrument boys to get baseline readings. From there it moved into more interesting territory, questions about the man dropped off in Times Square. Dunne watched closely, attentive to Kitano’s every gesture. He appeared calm, answering in simple declarative sentences.

Finally the interrogator nodded to Dunne.

“All right, Hitoshi,” Dunne said. “Talk. Do you know who the woman is? Or are you just jerking us around?”

Kitano’s eyes met Dunne’s. “Did you find a tattoo on the victim? An Orchid flower? Anything like that?”

Dunne said, “Yes.”

Kitano nodded. “She goes by the name Orchid.”

“Orchid,” Dunne said. “How do you know?”

“I saw the photo. I recognized her.”

Kitano was correct. They’d picked up their first real information on the woman less than an hour ago. The name tattooed on the finger bone had set off alarm bells with the CIA station chief in Beijing.

“Who is Orchid?” Dunne asked Kitano.

“She is a kind of specialist. Known in the Chinese right-wing circles. It is rumored she was behind the bombing of Japan’s Yasukuni Shrine. Last year. And the murder of Kabawi.”

“Kabawi?”

“A conservative member of the Japanese legislature. He led the movement to purify the textbooks of anti-Imperial rhetoric. What your newspapers would call a
revisionist
. Denying the Rape of Nanking. The Korean comfort women.”

“Why does Orchid want you?”

“Many know of my past, what happened at Harbin. Her benefactor wants revenge.”

“Who does she work for?”

“There are rumors of a billionaire Chinese backer. Rabidly anti-Japanese.”

“No names?”

“Billionaires in China are a cancer. In 2003 there were none—now there are hundreds. It is very dangerous, such sudden power, sudden wealth. It amplifies one’s secret desires, secret prejudices. Such men are very dangerous.”

You should know
, Dunne thought. “Why did Orchid torture Liam Connor?” he asked.

Kitano’s demeanor changed at this question. Dunne saw it in his face, his body language. A chink in the man’s confident armor. Now they were getting down to it.

The room was silent. Dunne began to wonder if the old man had suffered a stroke.

Finally he spoke. “Do you know what happened after they destroyed the USS
Vanguard
back in 1946? About the confrontation I had with Connor on the USS
North Dakota
?”

A knock, and the door to the interrogation room opened. It was Dunne’s attaché. He passed Dunne a note. It said one word:
IMPORTANT
.

DUNNE STEPPED OUT INTO THE HALL. HIS DEPUTY WAS WAITING
. “What now?”

“In Ithaca. They found a woman shot dead near Maggie Connor’s workplace. No one can find Ms. Connor. Or her son. The police said there was a fire. And a second fire that was even stranger. Out in the sticks with the rednecks. Firemen found what looks like the remnants of a state-of-the-art biotech lab. The firemen also found two bodies inside, both with gunshot wounds. One of the victims was a Cornell professor, a friend of Jake Sterling’s.”

“Sterling? Has anyone spoken to him about this yet?”

“They can’t find Sterling, either.”

“What? But he should be at Detrick by now.”

“He never showed.”

“And why wasn’t I told?”

No explanation.

“Is everyone around here goddamned incompetent? Why didn’t Sterling show up?”

“No idea, sir.”

DUNNE WAS SHAKEN AS HE STEPPED BACK INSIDE THE INTERROGATION
room. He sensed a malevolent pattern, a dark web of danger just outside his reach. Now he wanted answers. “No more stalling, Hitoshi. Why did Orchid kill Connor?”

Kitano raised his right hand, highlighting his missing finger. “She is looking for a small brass cylinder. The length of the medial phalange finger bone. At Unit 731, I had it implanted in my finger. I was extracting it when Connor stopped me. He took it. I had no intention of bleeding to death, not before I released it. I am the seventh Tokkō.”

The light went on in Dunne’s head. “Connor kept the cylinder? He was holding on to a specimen of the Uzumaki all these years?”

“Yes.”

He leaned back, stunned. He thought of the reports from Ithaca, Maggie Connor going missing. The pieces snapped together, a cold knot growing in Dunne’s chest.