MOSAICS: A Thriller (19 page)

“Laura was very private about her personal life,” she told me. “She resented being known as the wife of the
famous
Dr. Lyons. She strived to push her work forward, to be known for what she’d done, not who she was married to—hold on, honey, the milk is almost ready.”

“Did she succeed?” I asked.

Something beeped, maybe a microwave. “Detective, in order to stay afloat in our line of work you have to either be smart and clever or act as if you were smart and clever. Does that make sense?”

“Perfectly. And Laura was neither?”

“Laura’s problem was that she didn’t believe in herself. She felt she was her husband’s shadow—one second, hon. Oh, please don’t step on Rufus’s tail!”

“She must’ve been angry when she found out her husband was cheating on her,” I hollered over the crying and the rattling and the barking.

“She was, but they’d already grown apart. They just happened to still live under the same roof. Laura and I jogged at the park together, before, you know,
this
happened.” I heard the bawling and assumed “This” was unhappy about the milk. The conversation got lost for half a minute, then the bawling magically stopped and she came back to the phone. “There was this guy we’d often see jogging. Laura said she found him sexy. I told her she should start dating again. She laughed and said why not. I was happy when she told me they were finally going forward with the divorce papers.”

“Do you know if she ever talked to this guy at the park?”

“If she did, she never mentioned.”

I asked for a description of the sexy guy, took note of where they’d jogged and when, then thanked her and wis
hed her all the best with her brood. Something crashed on the floor. A child howled. A dog barked. She didn’t run. She breathed into the receiver then replied, “What brood? I’ve got only one, he’s two and a half and he makes for ten.”

I had no problem believing her. “Good luck raising him,” I said. “Sounds like he’s ready to manage the LAPD.”

Next on my list were Laura’s close relatives, which weren’t many and scattered all over the country. Aside from the sister coming down from Sacramento, Satish had mentioned a disabled mother who wasn’t going to be able to leave her home for the funeral.

I flipped through my notes and found a phone number, area code from Olympia, Washington. I dialed and waited.  

Mrs. Fawn picked up at the third ring. “I was expecting your call,” she said once I identified myself. She had one of those soothing voices that had climbed the rises and falls of life. A voice that had cried a little, laughed a little, and then settled on a low croon, like a scratched LP that had been loved and played one too many times.

“I’
m sorry for your loss. Mrs. Fawn.”

“I’m not the only one who lost a child that night, Detective. Whoever did this to her is a lost child too.”

I stared vacantly at the wanted faces decorating the walls of the squad room and tried to picture them as lost children. I shrugged. They still looked like the usual bastards to me.

“Mrs. Fawn
, did your daughter tell you she’d filed for divorce?”

There was a pause so long I thought I’d lost the line.

“My daughter wouldn’t share things like that with me. Last I’d seen her was the day after Christmas. She came by herself, she said Freddy—”

I heard a rustle—
old fingers brushing over paper, or maybe a table. “We still call him Freddy. I suppose he’d be Dr. Lyons to you.”

I said he would. She carried on.
“Freddy was too busy to make it. He’s been too busy to come for the past five years.”

I sensed the scratches in her voice deepen. I figured I could get something out of it, so I dug further. “Do you think Freddy killed your daughter?”

Again, she took a long pause before replying. “Would I be surprised he did? The older I get, the fewer things surprise me.” I heard her swallow. “But then again, the way she was—”

I heard a rustle, then a lot of static. When she came back her voice had changed. “Did you look into her bank account yet?”

I frowned at the question. The papers were on Satish’s desk. “We just started,” I said. “Why?”

“I don’t mean the one she had with Freddy. I mean her stock portfolio. Ah, never mind, he’s probably going to inherit everything because they weren’t divorced yet, isn’t he?”

“I’m not sure, Mrs. Fawn. Why d’you ask?”

“She borrowed money to buy these stocks. Freddy talked her into it. I’d like to have my money back.”

My ears perked up. “What kind of stocks, Ms. Fawn?” I wedged the phone between my ear and shoulder and opened the laptop on my desk.  

“Jan-something. I think. Hold on.” She set the phone down. When she came back
something like a paper folder was rustling in her hands. “It’s right here… there.
Jank
, spelled like Bank, with a J. That’s the company.”

The name sounded familiar. I Googled
it. CEO’s name was Robert Kunst. Executives, lab directors—no trace of the name Lyons anywhere.

“Are you still there?”

“Yes, Mrs. Fawn, I’m listening. Laura borrowed money from you to buy stocks from Jank—how much?”

“A lot. The exact amount is irrelevant. Laura said it’d beat my retirement plan. She said the stocks would make us both rich. I’m sure Freddy got her into that.”

“Did she ever mention anything else about this company? Why was her husband so confident it was a good investment?”

“No idea. All I know is that it had to be his idea. She’d never done stocks before.”

“I gather you didn’t get rich?”

“I got tired of waiting, Detective.”

“Mrs. Fawn?”

“Yes.”

“Your other daughter said you won’t be coming for the funeral.”

She thought it over before replying. “She told you I’m paraplegic, didn’t she? Yeah, that’s my official excuse. Haven’t been out in ten years. I suppose I could come down, if I believed in all that. Don’t you wish you believed, sometimes, Detective?”

I let the question drift.

“My daughter’s looking at me right now. Laura is. She’s holding a lollipop and her lips are red and shiny from the sugar. She’s been fussing all day about that lollipop. I t
old her no, we’ve got to stop at a few more doors. People are happier to buy when you show up with a child. And my, she’s a cute child, she is. The books don’t sell, but I buy her the lollipop anyway. Because sometimes you just gotta follow your guts. To hell with encyclopedias, look at where they are right now. Nobody wants them anymore, it’s all on the Internet anyway. But the lollipop, that one lollipop makes her happy. And me with her. That’s my Laura, looking at me and smiling. There’s no other way I want to remember her.”

The scratches in her voice mended. She wished me good
night and hung up.

I stared at the screen of my laptop.

Jank Biologicals had been a small corporation until its main objective became HIV vaccine design. They bought Lyons’s vaccine patent in 2003. Lyons was listed under “benefactors” in the company’s “About” page. Under “Recent News” I found an article from 2005 that announced Jank’s IPO. I checked the dates on Google: the company went public the day after Lyons injected himself with his vaccine. It raised close to two billion dollars on the first day, selling over fifty million shares.

Smooth move, Doc. I’d inject myself too for that kinda money
.

I got up and
retrieved Laura’s bank statements from Satish’s desk. She’d made a $200,000 investment in shares from Jank in January last year. I opened Amy Liu’s file. March last year, $80,000. Jank, again.

Neither lady had a history of buying stocks before. This was their very first investment and it was huge.

I’m sure Freddy got her into that
, Laura’s mother said.

I checked
the market. Jank’s stocks had been doing exceedingly well. There were blips, here and there, as it often happens with stocks, but since 2007 the shares had over quadrupled their value.

Why was Mrs. Fawn
so sour
?

She probably never got her money back from Laura
…

Being the Fourth of July, there wasn’t even th
e slightest chance of getting ahold of Lyons’s bank assets. I wrote a note with my findings, dropped it on Satish’s desk, then flopped back into my chair.

A faceless kille
r. A maniac. The Byzantine Strangler
.

No. Psychopaths don’t follow patterns. They kill randomly.

Two docs in a row, both working on HIV… too much of a coincidence
.

I looked at Amy Liu’s phone logs. She called one number twice a week—her mother. I spotted several other regulars: friends, a hair salon, colleagues. Lyons’s cellphone number never
appeared, which didn’t surprise me. They probably had more than one occasion to arrange their meetings in person. I kept scanning the log from beginning to end and then all over again from the beginning. I found one instance of Lyons’s home number. Strange, not his cell. I flipped back, but out of a whole month, that was the only time the number appeared. The call lasted five minutes and forty-two seconds, and it took place four days before she was killed. Maybe it was just the invitation to the party.

Maybe
.

I left the squad room.
Save a few patrol cars on call, Los Angeles Street was deserted. I could hear the music and drums from the celebrations down on Olivera Street. It made me all the more desolate, so I drove through skid row just for the company. That part of town never misses its crowds.

Back at home,
there was no
lahmajoun
at my door, no envelope under the mat, no scarf, no nothing. My mood was as flat as a slashed tire. Thanks goodness for my two boys: Will did his usual “I’m so excited to see you” welcome dance as soon as I opened the door, and The King actually dignified me with a mew. They both followed me to the kitchen, where I served them dinner and opened a bottle of Brunello. The King gave two bites to his dinner then hopped on the countertop and stared intently at the wine.

“Best company on lonely nights,” I said.

He agreed.

I poured m
yself a glass, twirled it, then sipped. The King kept staring at me, the tip of his tail bending ever so slightly.

“Fine,” I said. I
took out a saucer and spilled a few drops of Brunello on it. Damn cat of mine licked it all up in two seconds. He licked his whiskers, too, then hopped back down on the kitchen floor and returned to his dinner bowl.

“Alcohol is bad for felines,” I said.

He chomped on his dinner and ignored me.

I shrugged.
“You’re too smart even to be a feline.”

The answering machine was blinking again. I left it blinking,
took my glass of wine and settled in the back porch to watch the fireworks from the Dodger Stadium. They crackled, hissed and whistled and turned the sky into a canvas of shimmering lights.

The Brunello
was ok.

Damn it. The hell with the Brunello
. It’s Diane I wanted. You can’t stop at just a sip of good wine, that’s a blasphemy. You have to get tight.

Diane had given me just sip. And man, did I want to get tight. 

SEVENTEEN

____________

Dr. Frederick Lyons leans over his desk and squeezes his temples between the heels of his hands. He looks tired. He looks tired and old. Shards of shattered dreams lay all around him, their edges as sharp as a scalpel.

What happened to you, Dr. Lyons?

“What do you want?” he snarls, without bothering to lift his head.

Some things haven’t changed.

Just give him time.

“You’re b—back to work, D—Doctor. I didn’t think—”

“What do you want, Medina?”

Medina stiffens. He swallows bitter hatred. To the rest of the world, it looks like he just cleared his throat. To the rest of the world, he looks like a turtle peeking out of its shell. “The new draft, sir,” he says, softly. This time he manages not to stutter.

Lyons dignifies him with a stare. “What draft?”

“The PNAS p—paper. The s—second r—rev—”

“Reviewer,” Lyons snaps.

“Yes. He w
-wanted to s-see more tests, so I r-ran those and—”

“Right.” Lyons draws in a sharp breath and leans back in his chair. His eyes glaze over. They seem sad, almost soft. What a heart-breaking view. “I asked Marianne to cancel my trip to Duke.”

“I understand—”

“And then I told her not to.”

Medina doesn’t reply. He squints and looks at the world through the small opening of his shell.

“They can’t stop me,” Lyons says. “Not like this. They won’t stop me like this.”

“Yes, s—sir.”

Lyons’s eyes focus back, sharply. “I need a dozen slides by next Wednesday.”

Medina stiffens. He swallows, again, then tiptoes to the desk, where he leaves the paper draft he’s brought along.

“A dozen should suffice,” Lyons goes on, his eyes glazing over again. Outside, a jackhammer rattles. A crane looms over the scaffolding across the street. “Show a couple of your neat graphs. Explain the algorithm, you know it best. The usual stuff.”

“Yes, sir.” Medina shuffles back to the door. “Oh, and s—sir?”

“Yeah?”

“My deepest condolences.”

Lyons frowns, taken aback. It’s just a moment and then he turns away, his eyes lazily following the block of cement dangling
out the window.

My deepest, deepest condolences. 

Medina limps down the hallway. His feet hurt, his hands prickle.

Damned moths, they suck the life out of me.

A dozen slides, your usual graphs. Explain the algorithm, you know it best.

Of course I know it best. It was my idea
to begin with.

He shuffles down the hallway back to his office. Nurses walk by. Lab technicians chat in the elevator lobby.

Nobody talks to Medina. Nobody seems to even notice he’s there.

Until they need something from me.

Medina the stutterer, the loser, the poor dude with the invalid mom.

Medina, the one they all pity.

He sits at his desk and logs into his machine.

The alignment he’s been working on opens up, mismatched columns of colors.

Four colors.

He reads the first line.

CAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAAGACGCAACCACCACTCTATTT…

No, wait. His eyes run back to the beginning of the line. He starts reading again.

CAAATTGTGGGTCAC…

That can’t be right. He jumps to the next line.

CAAATTGTGGGTCAC…

Damn it, an insertion. Stupid insertion made the whole region a stutter. Screwed up the whole alignment. Fucking software, if only there were one that did the job right. What’s the point of having machines if all the dirty work has to be done by hand?

He clicks on the edit tab and starts typing. Then he stops. A bright red drop sits on the A key. Another one drips on the G. The Space key is smeared.

Damn it.

He reaches for the Kleenex box, plucks out a tissue, wraps it around his left hand.

Damn it, damn it, damn it.

He wipes the keyboard clean, starts over. Menu, edit, insert gap column.

He stops, again. His hand hurts. He opens his fist, the Kleenex on his palm a clump of bloody shreds. Carefully he peels them off his skin and tosses them in trashcan. He examines the inside of his hand. Tiny lesions crowd at the base of his thumb and pinky. He balls his hand and fresh blood oozes out.

He squints.

Fresh blood and crawly, hairy legs, tiny spider legs, thousands of them, oozing out of his open skin like—

Argh!

He jumps out of his chair and leaps to the door.

Breathe. Just. Breathe
.

A beep from the computer makes him turn back to the screen.

“New message from lj66: Hey, would you look at this?” he reads on the monitor.

Medina takes a deep breath, shuffles back to his desk. He keeps his injured hand closed into a fist, while with the other he opens his inbox.

“Confidential data, I’m not supposed to send you this stuff,” he reads off the first line. John Wood, an old bloke from college. He works at TYU Labs now. They chat, from time to time. Nothing special.

What does he want now
?

“Pseudogenes,” the email goes on. “I bet you’ve never seen them like this. You’re gonna love it.”

Medina clicks on the attachment. His jaw drops, his hand no longer hurts. He lets go of the Kleenex he’s been squeezing and picks up the phone.

“I knew you’d love the data,” he
says. “It’s unbelievable, isn’t it? I wonder what it feels to have all this stuff going on in your body. You know, the normal genes, and then all the extra genes overlapping. It’s like—like that documentary on the Discovery Channel, the real superhuman, remember that?”

Medina thinks about it. Of course he remembers.
Seems almost too good to be true. All he’s been looking for, for years …

What perfect timing
.

He licks his lips and whispers softly
into the mouthpiece. “Wh-who’s the data f-from?”

John doesn’t reply right away. He lowers his voice. “Um, listen. Blood came from a client, a
geneticist down in San Marino. One of his patients. He wanted some dendritic cell tests, antibody titers, and peripheral blood PDCs. I found the gene expression tests from assays done on the patient last year. So, you know. I’m not supposed to share this stuff. It’s just a curiosity, I thought you might like it. Besides, the guy’s screwed. Look at those test results. He’s a battlefield of antibodies attacking all the tissues that express the supergenes. He’s toast. Nothing like what the documentary made you think.”

John chuckles, Medina doesn’t join in.

Medina’s thoughts are elsewhere right now. His fingers click on a terminal window, his brain fires with ideas.

Nothing’s anonymous once on the web, he thinks.

Nothing, not even firewalls.

And deep inside, he smiles.