Creation (31 page)

4
. In the 1980s, a team of lunar mechanics got to play with a huge amount of regolith, the powdery dust that makes up the moon's surface. A huge amount, in this case, is 40 g, about the equivalent of four tablespoons of sugar. This precious sample, brought home by the astronauts of Apollo 16, was cemented into tiny bricks, an inch-by-inch cube and a couple of other shapes, and was tested to destruction. The researchers concluded that “Lunar soil can be used as a fine aggregate for concrete.” One of the key ingredients of concrete, however, is water, and though the moon is not entirely desiccated, there isn't a lot of water there. In 2009, LCROSS was deliberately crashed into the Cabeus crater, a pit shrouded in permanent darkness on the south side of the moon. NASA very carefully watched the mile-long plume that erupted after impact and saw from its unique ultraviolet signature that water and ice puffed out. It's buried, though, and not available in quantities that would enable construction of a moon base.

5
. The
2012 grand prize winners were the iGEM team from the University of Groningen in the Netherlands, who built a circuit into bacteria that detects the chemicals produced when meat begins to spoil. The bacteria then produce a pigment visible to the naked eye, enabling consumers to see when meat is rotten.

1
. That particular movement was short-lived but weighty, and was crushed with ruthless force. Legislation was introduced in 1812 that specifically outlawed vandalism to machinery and made it a capital crime. Seventeen Luddites were hanged a year later, and many were sent to what was then the penal colony of Australia.

2
. Two smallpox samples are kept in cold storage for scientific purposes; there is an ongoing discussion about whether these should be kept or destroyed, primarily because of the risk of bioterrorism that they embody.

3
. To get published in a scientific journal requires peer review, in which other expert scientists rate the validity of the proposed publication and recommend it (or not) for publication. Yet it is not a hallmark of scientific truth, only a recognition that a group of scientists believe an experiment is worthy of entering the academic literature. In this case, some have disputed whether Séralini's paper should have been published at all. Historically, critical feedback came via the cumbersome method of publishing correspondence or replicating experiments in academic journals. Now there is a form of post-publication peer review enabled by the Internet, in which papers are scrutinized in blogs and columns and discussed openly. It's not formal and is subject to the wildness of a frontier without gatekeepers, but it is quick, and scrutiny was precise and harsh. By December 2012, though, the journal of the EFSA published a paper that concluded Séralini's study “was found to be inadequately designed, analyzed and reported,” and “of insufficient scientific quality for safety assessments.”

1
. Almost always, this pilfering is to cope with words on loan from foreign languages. French has virtually no uses for the letter
w
except in borrowed words, such as
“le weekend.”
Welsh acquired
j
to cope with English and Norman words and names. Languages and their alphabets contract and expand like living things.

2
.
A, G, C,
and
T
(
U
in RNA) arrange in genes into triplets, which together encode one of just twenty amino acids and three stop codons.

3
. In fact, our bodies make just eleven of these amino acids, and we need to ingest a further nine. There are two other amino acids life-forms infrequently use, one of which is exclusive to bacteria and archaea. In general, we tend only to refer to the canonical twenty.

4
. For example, six different combinations encode leucine:
UUA, UUG, CUA, CUG, CUC,
and
CUT;
see part I, chapter 5 for the reasons for the evolution of this redundancy.

5
. Amber stop is not named in relation to the intermediate warning at traffic lights, but because its discoverer's name was Bernstein, German for “amber.”

6
. As mentioned on page 140, it was the subject of a copyright challenge by James Joyce's estate.

7
. Which, in case you are wondering, looks like this in DNA:

TTAACTAGCTAATTTCATTGCTGATCACTGTAGATATAGTGCATTCTATAAGTCGCTCCCACAGGCTAGTGCTGCGCACGTTTTTCAGTGATATTATCCTAGTGCTACATAACATCATAGTGCGTGATAAACCTGATACAATAGGTGATATCATAGCAACTGAACTGACGTTGCATAGCTCAACTGTGATCAGTGATATAGATTCTGATACTATAGCAACGTTGCGTGATATTTTCACTACTGGCTTGACTGTAGTGCATATGATAGTACGTCTAACTAGCATAACTAGTGATAGTTATATTTCTATAGCTGTACATATTGTAATGCTGATAACTAGTGATATAATCCAACTAGATAGTCCTGAACTGATCCCTATGCTAACTAGTGATAAACTAACTGATACATCGTTCCTGCTACGTGATAGCTTCACTGAGTTCCATACATCGTCGTGCTTAAACATCAGTGATAACACTATAGAGTTCATAGATACTGCATTAACTAGTGATATGACTGCAAATAGCTTGACGTTTTGCAGTCTAAAACAACGTGATAATTCTGTAGTGCTAGATACTATAGATTTCCTGCTAAGTGATAAGTCTACTGATTTACTAATGAATAGCTTGGTTTTGGCATACACTGTGCGCTGCACTGGTGATAGCTTTTCGTTGATGAATAATTTCCCTAGCACTGTGCGTGATATGCTAGATTCTGTAGATAGGCTAAATTCGTCTACGTTTGTAGGTGATAGTTTAGTTGCTGTAACTAATATTATCCCTGTGCCGTTGCTAAGCTGTGATATCATAGTGCTGCTAGATATGATAAGCAAACTAATAGAGTCGAGGGGGAGTCTCATAGTGAATACTGATATTTTAGTGCTGCCGTTGAATAAGTTCCCTGAACATTGTGATACTGATATTTTAGTGCTGCCGTTGAATATCCTGCATTTAACTAGCTTGATAGTGCATTCGAGGAATACCCATACTACTGTTTTCATAGCTAATTATAGGCTAACATTGCCAATAGTGCGGCGCGCCTTAACTAGCTAA.