American Blood: A Vampire's Story (15 page)

Ryan sat at his workstation as the twelve sets of blood and tissue samples from Calida were analyzed by the sequencing equipment once again. He wondered if the results would match the previous run or, and it wouldn’t surprise him, provide yet another fork in the road of his research. Although he concentrated on his work, he could hear quiet footsteps drawing closer.

“Yes Professor?”

“Doctor Ryan,” Professor Balken began. “Why do you think Miss Calida was unaffected by the radiation from this stone while these other poor souls were not as fortunate?”

“I can’t offer any explanations, Professor.”

“Yet since these others never had any direct contact with it one would expect their exposure to be far less than Miss Calida’s.”

“She even drank water from the pool that the stone was resting in,” Ryan said. “Not only did she receive a higher exposure, it should have been lethal.”

“Have you considered, Doctor Ryan, that maybe it was?”

“What?”

“She must have received a lethal dose while the others received less.”

“Except for the fact that she didn’t die.”

“I have been giving this puzzle considerable thought,” Professor Balken said. “Not all particles that are the product of radioactive decay behave the same over a given distance.”

“All right, but we don’t even know what kind of particles this stone produced,” Ryan said. “Were they alphas, betas—maybe even gammas. There’s no way of knowing.”

Professor Balken cleared his throat then asked, “Are you aware that Miss Calida is hot?”

Ryan turned around and gave Professor Balken a disbelieving look. “That image she shared with us was something, and it’s still vivid in my mind, but Professor Balken . . . at your age?”

“I am referring to the fact that she is producing energetic particles, laddie.”

“She’s radioactive?”

“She is radiating, but exactly what, is another matter.”

“Your evidence is?”

Professor Balken Began rubbing his hands together, a sure sign to Ryan that he was about to receive a lecture. “When the cloud chambers are being used, a scintillation counter, which is one of the electronic devices that sits between the two chambers, records any transient particle counts.”

“I recognized you were using one. I figured you had a reason for it.”

“I only use it to track down any nearby sources that are causing errant tracks,” Professor Balken said.

“It makes sense.”

“Of course it makes sense. This scintillation counter, which is my special design, is directional and runs a time counter. The exact moment a particle is detected is recorded along with its energy. And if a particle is detected, the device gives off an audible click. I download the recording from the counter when I have time and usually give the data a cursory review.”

“Okay Professor, I’m piqued . . . go on.”

“The counter is directional in 360 degrees. It recorded a high particle count coming from a narrow ten degrees of arc.”

“But I don’t recall any clicks coming from any of your equipment. And the chamber didn’t show excessive tracks unless she was sending.”

“That is correct—”

“I got it,” Ryan said. “When Calida took her turn at the chamber you were able to confirm that particles struck the counter from her direction.”

“Exactly!  The ten degrees of arc was directionally inline with Miss Calida, but the energies that were recorded are nonsense, unfortunately.”

“How so?”

“They were zero. That is why no clicks were heard.”

“I didn’t know a radiated particle could have zero energy.”

“Radiated particles always have an associated energy,” Professor Balken explained. “These negative energy particles didn’t leave any tracks because they weren’t ionized. I suspect we have discovered something new, once more.”

“How might this relate to her exposure to the stone?”

“I would speculate the stone produces a different type of radiation at close distance. The type of radiation is unknown. Whatever it is, our little vampire is hot with it.”

“This stone would answer a lot of questions,” Ryan said.

“It must be the source of the untrihexium, on that there can be no doubt,” Professor Balken said. “And her intimate contact with this element had a different effect on her than the others who merely were in the same vicinity as the stone.”

“Different types of radiation for different distances?”

“And with different distances different effects.”

“I know we’re all thinking that this untrihexium has the power to turn someone into a vampire when touched,” Ryan ventured. “Calida certainly believes this.”

“That could only be determined if this stone was located and properly researched,” Professor Balken replied.

“That’s the last thing the world needs,” Ryan countered.   “Just look how much trouble the first person who touched it has caused. Yet I think in certain ways we got lucky it was her.  You follow?”

“I see your point, Doctor Ryan. What would happen if someone who is a monster to begin with got his hands on this stone . . . what might happen to the world?”

Ryan nodded and fell silent for a moment.

“Well, I must return to my work,” Professor Balken said. “Maybe this information will be useful to your research.”

“I was just thinking, Professor,” Ryan said. “The name untrihexium doesn’t do it justice.”

“I beg your pardon.” Professor Balken stopped and turned back toward Ryan.

“The name, you said the discoverer gets to name it.”

“You discovered this element, so yes, t’is your right.”

“Actually the credit for discovery goes to Calida. I thought we could call it ‘Calidium,’ but it’s too pretty a name for something so dangerous to us—to humans.”

“Then what other name do you propose?”

Ryan looked over at the HeliScopes. “Maybe a more fitting name is ‘Vampirenium.’ It fits right in with Californium and Plutonium,”

“Vampirenium it is,” Professor Balken said. “And it’s about time the periodic chart got something exciting.”

“Sure, now chemists have something they can really sink their teeth into,” Ryan offered.

Professor Balken cackled for a moment and then asked, “And the atomic symbol?”

“Vp.”

C
alida broke the water’s surface and spun around.
Manic’s Pleasure
had been reduced to a floating pyre. Her eyes were suddenly blinded by a brilliant flash as the fuel tanks exploded. The shockwave slapped her face. The flash and brightness of the fire made it difficult for her to see things clearly and she turned away from the flames to give her oversaturated eyes a moment to clear.

She reached up with her hand and pulled something out of her forehead. It was covered in her blood, but in the dancing yellow light of the fire she still recognized the object. It was the gold earring that the bodyguard had been wearing. She ran her fingers over the right side of her face. Her skin had been badly burned by the initial blast, but she felt no pain as the nerve endings had been obliterated. If she had been just a few steps closer, the device in her head would no longer be a worry for her.

The yacht began to roll onto its port side. The internal structure let out a low moan as the shredded stern twisted free from the hull and quickly disappeared. The fire began to rapidly fade and was abruptly extinguished as the hull continued its death roll until the bottom of the yacht was all that could be seen moving up and down with the ocean swells.

Calida’s night vision began to return now that it was dark again. Something floated nearby that looked like a body face down in the water. She swam over and turned him over onto his back. It was Manic. She had partially screened him from the blast, but the top half of his skull had been crushed by something. Maybe a piece of debris, or from when he struck the water. The blast had been that powerful. She could feel his heart still beating, but soon it would stop.

She didn’t give the situation a second thought and pulled him closer. She spit salt water out of her mouth and bit through the side of his neck. The warm gush of his blood filled her mouth with its own saltiness and she greedily swallowed the first mouthful. Calida continued to feed until his heart finally made its last beat. She let him go. She felt for the sun and figured she had about three hours left. She would have to make a swim for the island.

The faraway echo of a high-speed boat engine caught her attention. More engines joined in. She turned toward Catalina and could see a group of approaching lights rising and falling with the swells. The yacht’s fiery destruction hadn’t gone unnoticed from the shore. Another boat was coming from the opposite direction. It quickly closed the distance to where she was floating. As she came up with a rising swell she could see it drawing close, but all of its lights were out. It looked liked Manic’s business partners were returning which Calida thought to be foolish.

The boat came up to the capsized yacht and slowed down. A powerful search light shot out and began to move back and forth over the water. She could hear voices.

“Over there,” someone yelled. “The signal says we’re almost on top of her.”

The boat turned sideways in the swells and moved toward her. The search light swept over her head and came to a stop.

“That’s her, get along side,” a familiar voice said.

The boat came closer and a life buoy landed with a splash within an arm’s length. Calida reached for it and grabbed the hard foam. The boats engine was teased to idle and she was pulled along until she was at the stern of the boat. Calida let go of the life buoy and got a handhold on the aluminum ladder that had been lowered over the side. She climbed up. Just as she neared the top rung, four hands grabbed at her and pulled her onboard.

Calida fell to the fiberglass deck and looked up at her rescuers.

“I take it that you’ve completed your mission,” Allison said, her face betrayed her shock at the situation. “But I don’t know if blowing up the yacht was a smart move. Everyone on the east shore of the island probably saw, or at least heard, the explosion.”

“Not my problem,” Calida said. “I didn’t do it.” She pushed herself from the deck and stood up. “The explosives were inside a briefcase that was left behind in the cabin.”

Allison aimed a flashlight at Calida’s face. “Oh no,” she said. “The whole—the whole—side of your face has been ruined.” She turned away from Calida and added, “It’s a shame, really. You were so pretty. We need to get you medical attention. I don’t know how they’re going to repair the damage.”

“No, I’ll be fine,” Calida replied. “Just get me back to land. I need to be somewhere safe and dark.”

“Look, you’re in shock. If we don’t get you immediate treatment for these burns they’ll get infected. It’s bad enough without making things worse.”

“I don’t go into shock . . . just get me back to land.”

“Okay, it’s your face.” Allison shouted toward the small bridge, “Take us back! The ocean here is about to get crowded.”

“So why did you people need me if those bastards were just going to blow everyone up anyway?” Calida asked.

“We didn’t know they were going to do that,” Allison replied. “It’s incredible that you survived . . . you’re the only one who did.”

“Now what?”

Allison couldn’t help staring at Calida’s damaged face. “Where you able to get the information the agency needed?”

“I got it.”

“Then as soon as we get back to the dock a car will take you to the airport where a small agency cargo plane is waiting.”

“As long as it’s dark inside.”

“We really should get you emergency treatment. Those look like second and maybe even third degree burns on the right side of your face.” And Allison reached up and turned Calida’s head to the side. “It’s terrible, Agent Lopez. Even your ear is gone.”

“I don’t need any treatment,” Calida said, and allowed her upper lip to reveal her fangs. “I just need a nice long beauty sleep and I’ll be fine.” She gave Allison a quick violet flash from her eyes.

Allison stepped backward. “My God,” she said. “So it’s true. You really are what they said. But—but you’re not going to . . . um . . . hurt us, are you?”

“Calida smiled with half of her face. “No, I’ve had enough blood tonight. I just need to get back to a safe, dark place before the sun comes up.”

“Don’t worry, we’re going to keep you real safe.”

“Good, and my name is Calida.”

“Everything in the universe goes by indirection. There are no straight lines.”

—
Ralph Waldo Emerson
, American Poet

“L
ook at the stills from the cell’s rear cameras when they are superimposed,” Siri said as she overlaid the two images.

Less than an hour had passed since Ryan had spoken to Professor Balken when Siri walked into the lab. He could almost remember a time when research was a long and lonely undertaking.

“And here’s the enhancement,” she continued. Siri selected the portion of the observation window caught by both rear cameras and adjusted the brightness and contrast bars.

Ryan studied the selected area for a moment. “Well, there does seem to something there,” he said at last.

“When Christopher walked in the lights inside her cell were turned way down as Calida preferred. In fact they were at a lower brightness level than the lights outside on the observation platform.”

Ryan watched as Siri patiently tapped her fingers on the mouse and said, “Since there was less light reflecting back at the cameras from inside they were able to partially see through the one-way.”

Siri reached toward the display and just about touched it with a fingertip. “Now you tell me that isn’t someone standing outside the one-way glass for the last few minutes of the video,” she said.

“Doesn’t look like much . . . go back and slow down the frames,” Ryan asked. “Let’s see if we can catch the exact moment when that shadow—”

“Shadow?”

“Right now it’s a shadow,” Ryan said. “So let’s see if it moves into the frame from the right.”

Siri slid the time counter on the screen backward to just before Calida looked up toward the observation window for the first time. She then clicked forward using the mouse one frame at a time.

“Nothing . . . nothing . . . stop. Hmm, there it is,” Ryan said. He leaned closer to the display. “Who do you suppose that is?”

“I don’t think it’s a guard,” Siri replied.

“No, a guard would have rushed in and stopped her.”

“Someone stood there and watched the killing, why?”

“And there’s the conveniently relaxed security,” Ryan replied.

Siri reached for the keyboard and typed something in a text window on the display. Ryan looked at the name and nodded.

“I guess that’s all I have for now,” Siri said, and the tone of her voice changed. She held Ryan’s gaze with her expressive eyes for a moment.

Ryan understood and said, “I’m sure everything will fall into place soon enough.”

Siri smiled at Ryan and asked, “Anything new between you and the Professor today?”

Ryan looked down toward the far end of the laboratory where Professor Balken was intimately hunched over the CRAIC Microspectrometer, which looked like a large binocular microscope. “I’ve only been here for two hours,” he replied. “But, if you must know, we have made some interesting progress.”

“Don’t keep me in suspense.”

Ryan nodded toward the back of the lab. “The Professor has informed me that Calida is hot.”

“You two need to try getting along better.”

“Uh huh, he has evidence that she’s radiating something,” Ryan said. “Some new type of radiation that exhibits strange properties.”

“She radiates in many ways,” Siri said. “So what have you two come up with?”

“Not much other than the obvious connection with the stone.”

“Everything about her does seem to begin with it.”

Ryan leaned forward. “The Director is expressing a great interest in this new element. He’s been requesting daily updates on our research regarding it and the stone. Everything else, the genetics, he seems to be less interested in.”

“That’s interesting,” Siri said. “Two days ago he had me supply all of the historical information I’ve accumulated about those caves. I had to provide detailed geographical data on the Serpis River. The stone has made an impression on him.”

“That’s disturbing,” Ryan said.

“What are you thinking?”

Ryan again glanced toward the back of the lab and in a quieter voice said, “Anything he becomes interested in either seems to die, suddenly, or is manipulated into his plans.”

“Do you think he might be . . . .”

“Please don’t say it.”

“Well, is he?”

“Can you think of a worse person to get his hands on something like this stone?” Ryan asked.

“Even if he is considering it,” Siri said. “He’s a long way from getting a sense of where these caves might be. I’ve spent months trying to figure out their location from the available information. There’s just too much geology both on and near this river. There are caves all over Valencia. Hundreds. Thousands.”

“At least that should keep him busy.”

“But can it really turn a person into a vampire?” Siri asked.

“How about we don’t find out?”

“It’s not going to be that simple.”

“And what if he did somehow find it? What do you think he’d do with it?”

“We shouldn’t be talking about this, here?” Siri whispered.

Ryan straightened up and cleared his throat. “Not a problem, I have white noise generators broadcasting a screen. Plus, I’ve told the Director that some of the detectors in here are several orders of magnitude more sensitive than anything his agents might deploy in the field. Any small electrical fields from any listening devices in here could interfere with my instrumentation.”

“This paranoia from you, it—it actually pleases me,” Siri said.

“You’re welcome,” Ryan volunteered. “Besides, he knows he has nothing to fear from us. We’re just a couple of pawns on his chessboard.”

“That’s comforting.”

“Anyway, I decided not to go with Calidium for the new element.”

“Why? I liked it.”

“Not sinister enough.”

“And?”

Ryan told her his name for the untrihexium.

“Did Henry put you up to this?”

“Not at all.”

Siri leaned back against the laboratory bench and let out a sigh. “I thought we were going to do something here, with her, something important. We’ve barely scratched the surface.”

“We are gaining ground,” Ryan said. “I think we’ve at least established that her abilities aren’t the result of some mythical evil power.”

“I never thought it would be,” Siri said. “The world has all the evil it needs from us.”

“Right, but what’s going on—what happened to her—is cause and effect. We think we know the cause, we just need to figure out how the effect works.”

“But this stone—your Vampirenium—do you see that if it’s found someone could open up the proverbial Pandora’s Box?”

“If all it does is turn you into a vampire what’s the benefit?” Ryan replied with his own question. “What’s the payoff?”

Siri slowly blinked at him several times and in a hushed voice said, “If your Vampirenium really is a seven day fountain of youth these . . . these side effects would be overlooked, I’m afraid.”

“I don’t think it’s that straight forward,” Ryan said. “At this point all we can say is that the stone might turn a leper into a vampire. We don’t know what it might do to someone else.”

“You really think there’s a connection with her disease?” Siri asked.

“I’m certain of it,” Ryan replied. “Half of this microbe’s DNA just sits and does nothing. It’s a degraded genome with large regions of pseudo genes, but look at this . . . .” Ryan entered some keystrokes and a window appeared on his display with lines of base sequences. “You see this first line?”

Siri looked at the display.

“This sequence . . .” Ryan moved his pen along a string of characters on the screen:

. . . ACGGTTGCGGTATCCGTGACGGGAACTA . . .

“. . . is from a region of Calida’s DNA. It and several others like it, shows up in all her samples. The irony is,” and Ryan shrugged, “it’s the first gene sequence I obtained from her skin.”

Siri smiled at him but didn’t say anything.

“Yeah, it’s funny to me too,” he said. “They are extremely small sequences, less than a hundred bases in length, but they are an exact match for a gene sequence that is part of
Mycobacterium leprae’s
genome.”

“Can you identify a specific gene yet?” Siri asked.

Ryan nodded. “That sequence is from a
leprae
gene that codes for a secreted antigen. And Calida has these sequences incorporated into her own DNA.”

“So this stone, this element, somehow fused her human DNA and
leprae’s
together?”

“Fused, mutated, politely persuaded . . . call it what you want, but given this data, and the fact that
leprae
is an example of reductive evolution, we have to wonder what would be the result if a normal, healthy person came in contact with this stone. It might do something different, perhaps even worse.”

“This, this scares me more than she does,” Siri said.

“I’m with you—and you know those prions she secretes from her skin that bind to areas of our brains controlling suggestion?” Ryan watched Siri nod. “Those prions contain the protein compliment to the
leprae
sequence I just showed you. Those cylinders serve multiple functions. They
are
the prions and probably also have something to do with her ability to change appearance and who knows what else.”

“How long do you think her abilities took to develop once she contacted the stone?” Siri asked. “And why would she even evolve the ability to control, or read people’s thoughts?”

“I think you have it,” Ryan replied. “It evolved. Why did bats evolve the ability to echo-locate?”

“Probably to find prey—food.”

“Same thing must be at work with her. She can infect multiple people at the same time and pick each one off whenever she needs to feed.” Ryan sighed. “The Vampirenium somehow mutated her genome with
leprae’s
and over time she evolved this predatory mechanism so she can acquire her favorite food as efficiently as possible.”

“Us.”

Ryan nodded. “
Leprae
is an obligate parasite totally dependent on an intracellular existence.  And Calida is also an obligate, but in a different way.”

“Without us she can’t survive.”

“Right, but she only uses us as food . . . what if someone wanted to become like her but had a specific agenda?”

“Which is why this stone needs to stay lost.”

“Permanently.”

“I don’t think there’s any imminent danger of it being found.”

“Probably not. I just hope there aren’t more of these stones sitting around inside caves waiting to be discovered.”

C
alida slept through the entire return flight from Los Angeles. They had placed her in a large metal canister that was used to carry short range missiles by the air force. The inside had been stuffed with heavy foam along with an air mattress to accommodate her. Heavy duty holding straps made sure she didn’t get bounced around.

The flight left LAX at 11:00 AM and touched down at

Andrews at 9:20 PM. Calida came out of her day-sleep during the truck ride from the airbase to the facility. She didn’t panic when she woke up inside the pitch black canister. Claustrophobia in a dark place was one demon that she had cast out ages ago.

The truck made a stop and they started moving again. After a few minutes of slow travel it again stopped, went up a small incline, and came to a final stop as Calida heard the engine shut off. She heard footsteps outside her confines and then the loud snaps of metal latches. The canister opened up and two male agents reached towards her and undid the straps.

“Get out,” one of them said.

Calida sat up and touched her face. Not quite done healing, but almost, she decided. She looked out the rear of the truck. The driver had pulled inside the same receiving bay from where she left three nights ago.

“C’mon, get going,” the same agent instructed.

“What’s the rush?” Calida asked, and she took an immediate dislike to the tone of his voice.

“We have orders to get you back to your room ASAP. Now either you get out or we’ll pull you out.”

“You think the two of you can force me?”

The agent reached inside the canister and grabbed her arm and said, “Have it your way.”

Calida took hold of his wrist with her free hand and twisted. “Don’t ever touch me again, do you understand?”

The agent writhed around trying to free his arm, but Calida held onto him as if he was a doll.

“You’re
breaking
it,” he forced out, the tone of his voice now an octave higher.

Pleased with herself, Calida released his wrist the instant before the bones would snap. “You’re welcome,” is all she said and stepped from the canister. She walked out of the truck leaving the agent doubled over holding his wrist.

The second agent gave her an uncomfortable look. “Listen, Miss,” the other agent said. “He learned his lesson, and I don’t need you to repeat it, okay?”

“Okay with me,” Calida replied.

The agent relaxed and took a breath. “How about you just walk with me and I’ll take you back to your room.”

“Room? You’re joking, right? It’s a prison.”

“The Director wants to debrief you and he’s waiting. So please?”

“Tell your friend to be polite next time,” Calida said.  “It would have saved him from the lesson.” Calida looked back inside the truck at the agent who was now leaning up against the canister wriggling his fingers. “But if he’s as stupid as I think, next time I’ll do more than just break it. I’ll bite his hand off.” Calida was amused with herself, she couldn’t recall ever doing that to someone.

The agent nodded and motioned for her to follow him. He led her to a door at the rear of the docking bays and they walked out into the night. Two other agents who had been waiting outside joined them and escorted her back to the medical clinic.

She watched the steel door slide open and when they arrived at the air lock, the guard who had been polite said to her, “You go inside by yourself. We’ll just stay out here and make sure, uh, make sure . . . look, you understand?”

“No problem sweetie,” Calida responded. “I can sense everyone has strong feelings for me.” She stepped inside the air-lock and turned her back on the men.